“The Code Breaker” begins at the onset of COVID with UC Berkeley’s Jennifer Doudna, “a superstar for her role in inventing the gene-editing technology known as CRISPR.” Walter Isaacson explains: “In their DNA, bacteria develop clustered repeated sequences, known as CRISPRs, that can remember and then destroy viruses that attack them.”
Isaacson offers some historical context: “Two revolutions coincided in the 1950s. Mathematicians, including Claude Shannon and Alan Turing, showed that all information could be encoded by binary digits, known as bits. This led to a digital revolution powered by circuits with on-off switches that processed information. Simultaneously, Watson and Crick discovered how instructions for building every cell in every form of life were encoded by the four-letter sequences of DNA. Thus was born an information age based on digital coding (0100110111001) and genetic coding (ACTGGTAGATTACA).”
After the breakthroughs of Watson and Crick, scientists were focused on learning all they could about DNA: “At the time of the Human Genome Project, RNA was seen as mainly a messenger molecule that carries instructions from the DNA that is nestled in the nucleus of the cells. A small segment of DNA that encodes a gene is transcribed into a snippet of RNA, which then travels to the manufacturing region of the cell. There this ‘messenger RNA’ facilitates the assembly of the proper sequence of amino acids to make a specified protein.
“These proteins come in many types. Fibrous proteins, for example, form structures such as bones, tissues, muscles, hair, fingernails, tendons, and skin cells. Membrane proteins relay signals within cells. Above all is the most fascinating type of proteins: enzymes. They serve as catalysts. They spark and accelerate and modulate the chemical reactions in all living things. Almost every action that takes place in a cell needs to be catalyzed by an enzyme. Pay attention to enzymes. They will be RNA’s costars and dancing partners in this book.”
Close to 70 years later, with the help of Gavin Knott and Jennifer Hamilton, members of Jennifer Doudna’s exceptional CRISPR team, Isaacson attempts to do what he has written about in “The Code Breaker:” “Our plan, Hamilton says, is to make a double-strand break at a targeted place in the DNA of the human cell. In addition, we will supply a template so that a new gene will be inserted. The human cell we start with has been engineered to have a gene that creates a fluorescent protein that glows blue. In one of our procedures, we will use CRISPR-Cas9 to cut the gene and thus deactivate it. This means that the cell should no longer glow. In another sample, we will supply a template that the cell will then incorporate, changing three base pairs of the cell’s DNA in order to make the fluorescent protein change from blue to green …
“At the end of the full editing process, I am able to look through a fluorescent microscope and see the results. The control group still glows blue. A group that had been cut with CRISPR-Cas9 but not supplied with a replacement template doesn’t glow at all. And finally, there is the group that we had cut and then edited. I look into the microscope and see them glowing green! I have edited — well, Hamilton has actually edited, with me as an eager copilot — a human cell and changed one of its genes …”
So Walter Isaacson has demonstrated the end result of many decades of research conducted by so many scientists across the globe. And by editing genes, he has accomplished a marvel unimagined years ago, a feat even a writer can now perform.
A professor at Tulane, former chair of CNN, and author of several important biographies, Isaacson recounts the many small but amazing breakthroughs that have brought us this miracle: “For the first time in the evolution of life on this planet, a species has developed the capacity to edit its own genetic makeup. That offers the potential of wondrous benefits, including the elimination of many deadly diseases and debilitating abnormalities. And it will someday offer both the promise and the peril of allowing us, or some of us, to boost our bodies and enhance our babies to have better muscles, minds, memory, and moods.” [emphasis added]
Not surprisingly, Isaacson points out, these opportunities raise critical questions: “Is there an inherent goodness to nature? Is there a virtue that arises from accepting what is gifted to us? Does empathy depend on believing that but for the grace of God, or the randomness of the natural lottery, we could have been born with a different set of endowments? Will an emphasis on personal liberty turn the most fundamental aspects of human nature into consumer choices made at a genetic supermarket? Should the rich be able to buy the best genes? Should we leave such decisions to individual choice, or should society come to some consensus about what it will allow?”
As I’m writing this, these new capacities have brought us the messenger RNA-based COVID vaccines, which hopefully will halt the most devastating effects of the pandemic. Still, the New York Times COVID Tracker warns: “Berkshire County, Mass. Unvaccinated people are at a high risk for COVID-19 infections. The average number of new cases in Berkshire County fell to 3 yesterday, a 5 percent decrease from the day before. Since January of last year, at least 1 in 19 people who live in Berkshire County has been infected, and at least 1 in 437 people has died.” While 52 percent of Massachusetts residents have been fully vaccinated, only 44 percent of Berkshire County residents over 18 have been fully vaccinated. That’s less than the 51 percent of all Americans over 18 who have been vaccinated.
Most of us are trying to put COVID behind us, but we have paid a dear price: 590,212 deaths, 33,041,551 cases, all caused by a virus that is basically, as Isaacson reminds us, a “deceptively simple little capsules of bad news … They are just a tiny bit of genetic material, either DNA or RNA, inside a protein shell. When they worm their way into a cell of an organism, they can hijack its machinery in order to replicate themselves. In the case of coronaviruses, the genetic material is RNA, Doudna’s specialty. In SARS-CoV-2, the RNA is about 29,900 base letters long, compared to more than 3 billion in human DNA. The viral sequence provides the code for making a mere 29 proteins.”
“Here is a sample snippet of the letters in the coronavirus’s RNA: CCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUC. That sequence is part of a string that codes for making a protein that sits on the outside of the virus shell. The protein looks like a spike, which gives the virus, when viewed through an electron microscope, the appearance of a crown, hence corona. This spike is like a key that can fit into specific receptors on the surface of human cells. Notably, the first twelve letters of the sequence above allow the spike to bind very tightly to one specific receptor on human cells. This evolution of this short sequence explains how the virus could have jumped from bats to other animals to us.”
Having had my two Pfizer shots, I thought it might make sense to learn about what I was relying on. Luckily, Walter Isaacson focuses on the work of Jennifer Doudna and so many other scientists, revealing the mental journeys which thankfully led to the COVID vaccines we all need so badly. “The Code Breaker” is as impressive a book as the people he profiles, and the hard, essential work they have done and are doing. It defies simple condensation. So if you’re interested in how we’ve gotten to this place, if you’re interested in science and how it happens, and who makes it happen, or have a son or daughter who might be, get yourself a copy.
We have learned over the last five years about the profound power of misconception, misperception, and the corrosive capacity of myth and disinformation to triumph over truth. The Big Lie prospers. Smaller lies hinder our ability to heal. “The Code Breaker” dispels one oft-repeated claim of those opposed to COVID vaccinations – the supposed and untrustworthy rush to get an insufficiently vetted vaccine to market. In fact, we are fortunate to be the recipients of peer-reviewed work done decade after decade by a remarkably varied group of scientists spread across the world, whose dedication, obsession, ambition, and enduring passion for thorough research unraveled the previously unknown secrets of how our DNA works, then how RNA works. And what we might be able to do with that knowledge.
Filled with fascinating science, Isaacson’s book is also committed to telling some of the personal stories of the CRISPR scientists, in all their flawed but inspiring humanity. It offers many small but significant detective stories, one woven into another, revealing how we as a species unraveled scientific mystery after mystery to chart the building blocks of human life. The work that proved absolutely critical to enable the COVID vaccine I just took.
Let me offer one very small example that stood out for me: the gloriously unexpected contribution of Rodolphe Barrangou, a Parisian who journeyed to North Carolina to gain his master’s degree in pickle and sauerkraut fermentation, then earn his doctorate. He married another food scientist and moved to Madison, Wisconsin. There, she found a job with Oscar Mayer, and he found a job as research director for a division of Danisco that produces bacteria cultures for fermented dairy products, including yogurt. Little did I know that bacteria have been successfully fighting viruses for billions of years. Little did I know that, besides thanking the kind nurses who painlessly administered my Pfizer shots, I owed gratitude to someone like Barrangou, who needed to figure out how his company’s yogurt bacteria could better defend themselves against the ever-changing deadly viruses that threaten them.
Back to Doudna. It wasn’t so long ago that, like the rest of the United States, U.C. Berkeley was shutting down. Then, when her son’s high school robotics challenge was cancelled, Doudna “realized her world, and the world of science, had changed. The government was fumbling its response to COVID, so it was time for professors and graduate students, clutching their test tubes and raising their pipettes high, to rush into the breach.”[emphasis added]
Jennifer Doudna is star number one of “The Code Breaker.” While acknowledging all the significant contributions made by those on her team, and on the other CRISPR teams competing with them, Isaacson saw in her a singular persistence, a sharp inquisitiveness, and a competitiveness, all combining to make her a great innovator.
Let me admit my limitations when it comes to the science at the heart of “The Code Breaker” – many of you will better understand the chemistry, biochemistry, and microbiology Isaacson writes about. But what most impressed me was his ability to bring to life the extraordinarily varied people doing this critical work. Many of whom others have considered weird and idiosyncratic, difficult and quirky.
Jennifer Doudna, for example, moved with her family to Hawaii at age seven. She was a “haole” in Hilo, a blonde, blue-eyed non-native, imagining herself “a complete freak … really alone and isolated at school.”
Like some of the other creative people Isaacson has written about, Doudna “grew up feeling alienated from their surroundings.” And paid a price. Ostracized, she developed stress-related digestive problems: “‘Kids would tease me every day.’ She retreated into books and developed a defensive layer. ‘There’s an internal part of me they’ll never touch,’ she told herself … ‘My formative experience was trying to figure out who I was in the world and how to fit in in some way.’”
Science saved her, as it did so many other stars of the book. Luckily, her father gave her a copy of James Watson’s “The Double Helix.” “She quickly became enthralled by the race to understand the structure of DNA, especially taken by the accomplishments of Rosalind Franklin: ‘I guess I noticed she was treated a bit condescendingly, but what mainly struck me was that a woman could be a great scientist … The book made me realize you could also hunt for the reasons why nature worked the way it did … I have always loved mystery stories … Maybe that explains my fascination with science, which is humanity’s attempt to understand the longest-running mystery we know: the origin and function of the natural world and our place in it.’” [emphasis added]
But as enthusiastic as she was, like so many other women, Doudna wasn’t so readily welcomed to take her place in the world of science. Wanting to study chemistry in college, Doudna was discouraged by her male high school guidance counselor from taking the College Board chemistry test: “‘No, no, no … Girls don’t do science,’ he asserted. ‘It hurt me,’ Doudna recalled, but it also stiffened her resolve. ‘I will show you. If I want to do science, I am going to do it.’” At the age of 17, in 1981, she was accepted by Pomona College in California.
Add George Church to the cast of characters who grew up feeling alienated from their surroundings. “George Church of Harvard, Doudna’s longtime friend … grew up in the marshy exurbs of Clearwater, on Florida’s Gulf Coast near Tampa, where his mother went through three husbands. As a result, George had many last names and different schools, which made him feel, he says, ‘like a real outsider.’ … The young Church was fascinated by science. In those days when parents were less overprotective, his mother let him roam alone in the marshes and mudflats near Tampa Bay, hunting for snakes and insects. He would crawl through the high swamp grass collecting specimens …
“When George was 9, his mother married a physician named Gaylord Church, who adopted George and gave him a permanent surname. His new stepfather had a bulging medical bag that George loved to rummage through. He was particularly fascinated by the hypodermic needle, which his stepfather used liberally to administer painkillers and feel-good hormones to his patients and to himself.” Church told Isaacson: “My father would let me give his women patients hormone shots, and they loved him for it … and he let me give him shots of Demerol. I later realized he was addicted to painkillers.”
In his two years at Duke, Church qualified for two undergraduate degrees, yet became so obsessed with using crystallography to delineate the structure of RNA molecules, he was kicked out of their doctoral program. But since he had already coauthored five important papers, he was admitted to Harvard Medical School where “he worked with Nobel laureate Walter Gilbert to develop methods for sequencing DNA …When Jennifer Doudna was a PhD student at Harvard in the late 1980s, she admired Church’s unconventional style and thinking …
“During the 1980s, Church worked to create new gene-sequencing methods. He became prolific not only as a researcher but as a founder of companies to commercialize the work coming out of his lab. Later he focused on finding new tools for gene editing …”
Back to Doudna, who, at Harvard, worked with Roberto Kolter, studying “how bacteria make molecules that are toxic to other bacteria. She was responsible for cloning (making an exact DNA copy of) genes from the bacteria and testing their functions. She thought of a novel way to set up the process, but Kolter declared it wouldn’t work. Doudna was stubborn and went ahead with her idea. ‘I did it my way and got the clone,’ she told him. He was surprised but supportive. It was a step in overcoming the insecurity that lurked inside her.”
She worked on her dissertation with Jack Szostak, studying DNA in yeast. “She engineered strands of DNA that ended with a sequence that matched a sequence in the yeast. With a little electric shock, she opened up tiny passageways in the cell wall of the yeast, allowing the DNA that she made to wriggle inside. It then recombined into the yeast’s DNA. She had made a tool that could edit the genes of yeast.”
In the early 1980s, Thomas Cech and Sidney Altman won the Nobel Prize for their discovery “that some forms of RNA could likewise be enzymes … [and] can split themselves by sparking a chemical reaction … [So] if some RNA molecules could store genetic information and also act as a catalyst to spur chemical reactions, they might be more fundamental to the origins of life than DNA, which cannot naturally replicate themselves without the presence of proteins to serve as a catalyst.”
Szostak suggested that Doudna focus on whether RNA could copy itself. She told Isaacson: “When I was taught biology, we learned about the structure and code of DNA, and … RNA was treated as this dull intermediary … I was quite surprised to find that there was this young genius, Jack Szostak, at Harvard who wanted to focus a hundred percent on RNA because he thought that it was the key to understanding the origin of life.”
Which meant doing something many thought much too difficult, charting atom by atom the structure of some self-splicing RNA. “Specifically, she needed to figure out the folds and twists of the three-dimensional structure of self-splicing RNA.”
Which ended up taking more than two years: crystallizing the RNA, learning how to use liquid nitrogen to ensure the crystals didn’t break down when exposed to X-rays, and discovering the need for osmium hexamine, “a molecule which interacted in some of the nooks of the RNA molecules” and helped to create “an electron-density map that provided clues for the structure of a folded region of the RNA.” Together, she and her graduate student and future husband, Jamie Cate, had managed to determine “the location of every atom in a self-splicing RNA molecule.” And showing how it created its three-dimensional shape.
Isaacson explains that “Just as the double-helix structure of DNA revealed how it could store and transmit genetic information, the structure discovered by Doudna and her team explained how the RNA could be an enzyme and was able to slice, splice, and replicate itself …
“‘We hope our discovery will provide clues as to how we might be able to modify the ribozyme so that it can repair defective genes,’ she said. It was a momentous statement, though she didn’t think about it much at the time. It would be the beginning of a quest to translate basic science about RNA into a tool that could edit genes … One possibility is that we might be able to cure or treat people who have genetic defects.” [emphasis added]
Isaacson links the struggle to unlock the secrets of RNA with Doudna’s efforts to better understand her own personal journey and relationship with her father, whom she cared for when he was dying of cancer: “‘It was only after he died that I realized how influential he was in my decision to become a scientist,’ Doudna says. Among the many gifts that he gave her was a love of the humanities and how it intersects with the sciences. The need for that was becoming clearer to her as research led her into realms that required moral guideposts as well as electron-density maps. ‘I think my father would have loved to understand CRISPR,’ Doudna reflected. ‘He was a humanist, a humanities professor, who also loved science. When I talk about CRISPR’s effects on our society, I can hear my father’s voice in my head.’”
Isaacson explains: “Eventually, she and Szostak were able to engineer a ribozyme that could splice together a copy of itself … [and] Doudna became a rising star in the rarefied realm of RNA research … [as] over the next two decades the understanding of how little strands of RNA behaved would become increasingly important, both to the field of gene editing and to the fight against coronaviruses …”
“Doudna also became interested in a phenomenon known as RNA interference. Normally, the genes encoded by the DNA in cells dispatch messenger RNAs to direct the building of a protein. RNA interference does just what the name implies: small molecules find a way to mess with these messenger RNAs … by deploying an enzyme known as ‘Dicer.’ Dicer snips a long piece of RNA into short fragments. These little fragments can then embark on a search-and-destroy mission: they seek out a messenger RNA molecule that has matching letters, then they use a scissors-like enzyme to chop it up. The genetic information carried by that messenger RNA is thus silenced …
“Doudna showed that it acted like a ruler that had a clamp at one end, which it used to grab on to a long RNA strand, and a cleaver at the other end, which it used to slice the segment at just the correct length.” Then Doudna and her team discovered that Dicer can be reengineered, which enabled scientists to use RNA interference to turn off a wide variety of genes. Which helped them figure out what each gene did and regulate its activity for medical purposes.
Isaacson emphasizes the importance of RNA interference: “Throughout the history of life on our planet, some organisms (though not humans) have evolved ways to use RNA interference to fight off viruses. As Doudna wrote in a scholarly publication back in 2013, researchers hoped to find ways to use RNA interference to protect humans from infections…”
There’s another remarkable and idiosyncratic woman at the heart of this story: “Emmanuelle Charpentier, an itinerant French biologist who had an alluring mix of mystery and Parisian insouciance. She, too, had been studying CRISPR, and she had homed in on the CRISPR-associated enzyme known as Cas9.”
“Charpentier grew up in a leafy suburb on the Seine south of Paris … One day when Charpentier was 12, she walked past the Pasteur Institute, the Paris research center specializing in infectious diseases. ‘I am going to work there when I grow up,’ she told her mother.”
At the Pasteur Institute, Charpentier “learned how bacteria can become resistant to antibiotics.” And then worked “in 10 institutions in seven cities in five countries … With no spouse or family, she sought out changing environments and adapted to them without any inhibiting personal ties. ‘I enjoy the freedom of being on my own, of not depending on partnership,’ she says. She hated the phrase ‘work-life balance’ because it implied that work competes with life. Her work in the lab and her ‘passion for science,’ she says, brought her a ‘happiness that is as fulfilling as any other passion.'”
* * *
All of my grandparents came from elsewhere — Italy on my mother’s side and Hungary on my father’s. Immigration, as I grew up, was considered a quite ordinary and positive part of the American experience, the Statue of Liberty a welcoming beacon. As we slip further and further into an ever-deepening fear of the outsider, “The Code Breaker” is an inspiring corrective. Whether it’s differences in gender or national origin or income, we would not be anywhere near to solving the COVID crisis without the patchwork quilt of those scientists brought here by their brave parents who immigrated from countries throughout the world. And whether they were born here or came to study and work here, we owe them never-ending gratitude. And the same is true of those living and working in countries, large or small, around the world.
There’s Yoshizumi Ishino, working at Osaka University, who in 1986, while identifying 1,038 base pairs of DNA of a gene in E. coli bacteria, discovered “five segments of DNA that were identical to each other. These repeated sequences, each 29 base pairs long, were sprinkled between normal-looking sequences of DNA, which he called ‘spacers.’ Ishino had no idea what these clustered repeats were …”
Four years later, Francisco Mojica, a Spanish grad student at the University of Alicante, is fascinated by archaea, which, like bacteria, are single-cell organisms without a nucleus. They exist in ponds with salt levels 10 times higher than the ocean. While trying to figure out the secret to their ability to thrive with salt, he spotted 14 identical DNA sequences, repeated at regular intervals. They seemed to be palindromes, meaning they read the same backward and forward.
Isaacson notes: “Eventually he found Ishino’s paper. The E. coli bacterium that Ishino studied is a very different organism from Mojica’s archaea. So it was surprising that they both had these repeated sequences and spacer segments. This convinced Mojica that the phenomenon must have some important biological purpose …” Later, scientists discovered these repeated sequences in 20 different species of bacteria. One night while driving, Mojica “came up with the name CRISPR, for ‘clustered regularly interspaced short palindromic repeats.’”
Ruud Jansen of Utrecht University in the Netherlands while studying tuberculosis bacteria, found genes that seemed to be associated with CRISPRs and which encoded directions for making an enzyme. He called them “CRISPR-associated,” or Cas, enzymes.”
By 2003, when Mojica was focused on figuring out the role CRISPRs played, the genomes of close to 200 bacteria had been sequenced (as well as those of humans and mice) … “What fascinated him were the ‘spacers,’ those regions of normal-looking DNA segments that were nestled in between the repeated CRISPR segments … the spacer segments matched sequences that were in viruses that attacked E. coli. He found the same thing when he looked at other bacteria with CRISPR sequences; their spacer segments matched those of viruses that attacked that bacteria …”
Mojica explained his continuing efforts to his wife: “‘I just discovered something really amazing,’ he said. ‘Bacteria have an immune system. They’re able to remember what viruses have attacked them in the past’ … What Mojica had stumbled upon was a battlefront in the longest-running, most massive and vicious war on this planet: that between bacteria and the viruses, known as ‘bacteriophages’ or ‘phages,’ that attack them. Phages are the largest category of virus in nature. Indeed, phage viruses are by far the most plentiful biological entity on earth … In one milliliter (0.03 ounces) of seawater there can be as many as 900 million of these viruses.”
Isaacson writes: “Almost from the beginning of life on this planet, there’s been an intense arms race between bacteria, which developed elaborate methods of defending against viruses, and the ever-evolving viruses, which sought ways to thwart those defenses. Mojica found that bacteria with CRISPR spacer sequences seemed to be immune from infection by a virus that had the same sequence. But bacteria without the spacer did get infected. It was a pretty ingenious defense system, but there was something even cooler: it appeared to adapt to new threats. When new viruses came along, the bacteria that survived were able to incorporate some of that virus’s DNA and thus create, in its progeny, an acquired immunity to that new virus. Mojica recalls being so overcome by emotion at this realization that he got tears in his eyes. The beauty of nature can sometimes do that to you.” [emphasis added]
There’s Martin Jinek (YEE-nik) who was born in the Silesian town of Třinec, then part of Czechoslovakia. “Jinek’s initial work in Doudna’s lab focused on how RNA interference works … Jinek knew that a full explanation required re-creating the process in a test tube … to isolate the enzymes that are essential to interfering with the expression of a gene. He also was able to determine the crystal structure of one particular enzyme, thus showing how it is able to cut up the messenger RNA …”
We need to add one more star to our story, Feng Zhang. “Feng Zhang of the Broad Institute of MIT and Harvard … was blessed with a cheery sweetness that made him uncomfortable displaying that trait … he had a natural humility that often masked his equally natural ambition. It was as if he had dual cores, one competitive and one beatific, that coexisted quite comfortably. He had a warm smile that rarely left his face except in those moments when the talk turned to competition — or the importance of Doudna’s achievements —at which point his lips would continue to smile, but his eyes no longer joined in … he was pushed by his mentor Eric Lander, the brilliant and sparky mathematician-turned-scientist who directed the Broad Institute, to compete for credit as well as for discoveries.
“Zhang’s journey, which is worthy of a book of its own, is one of those classic immigration tales that has made America great. He was born in 1981 in Shijiazhuang, an industrial city of 4.3 million people southwest of Beijing. His mother taught computer science, his father was a university administrator. The streets of the city were festooned with China’s customary banners of exhortations, most notably those touting the patriotic duty to study science. Zhang was sold. ‘I grew up playing with robot kits and fascinated by anything to do with science,’ he recalls.
“In 1991, when Zhang was ten, his mother came to the United States as a visiting scholar at the University of Dubuque, a gem nestled in an architecturally rich Iowa city along the Mississippi River … She got a job at a paper company in Des Moines and with her H-1B visa was able to bring her son to America the next year …
“‘My mother always told me to keep my head down and not be arrogant,’ Zhang says. … But she also instilled in him an ambition to be innovative and never passive. ‘She pushed me to make things, even on a computer, rather than play with things that other people had made.’ … [Eventually] his interests shifted from digital tech to biotech. Computer code was something his parents and their generation did. He became more interested in genetic code …
“After he got his doctorate in 2009, Zhang took a postdoc position at Harvard and began researching the gene-editing tools that were available at the time … Fortunately, he was working in the most exciting lab at Harvard Medical School, which was run by a professor who was beloved for embracing new ideas, sometimes wildly, and who fostered a jovial atmosphere that encouraged exploration: Doudna’s longtime friend, the avuncular and bushy-bearded George Church, one of the contemporary legends of biology and a scientific celebrity. He became for Zhang, as he did for almost all of his students, a loving and beloved mentor — until the day Church believed that Zhang had betrayed him.”
Isaacson makes clear that we are dealing with very human folks here, and that for all their brilliance, they are afflicted with the same desires for fame and glory as the rest of us, and they too can fall victim to envy and jealousy. The desire for, and pride of, individual accomplishment in the short run can sometimes overshadow the appreciation of and need for compromise and collaboration. And sadly, we learn how the competition to demonstrate how CRISPR is able to edit the genes of humans turned contentious. There’s mostly respectful competition between Charpentier and Doudna, but a growing lack of trust between Doudna and Zhang, and the serious sense of betrayal between both Church and Luciano Marraffini and Zhang. They quarreled about who discovered what first, who deserved more credit and less, and most seriously, whose patent application should prevail.
And yet, for all their individual focus and pride, so much of what they did demanded coordination. In the case of Charpentier and Doudna, they were first drawn together by mutual need. Isaacson writes of Charpentier: “She had studied the CRISPR system in living cells. To get to the next step would require biochemists who could isolate each chemical component in a test tube and figure out precisely how each one works. That is why she wanted to meet Doudna …
“Doudna found Charpentier to be charming: just a hint of shyness, or feigned shyness, along with an engaging sense of humor and very stylish aura. ‘I was instantly struck by her intensity but also her sly humor … I immediately liked her.’ They chatted for a few minutes and then Charpentier suggested they get together for a more serious discussion. ‘I’ve been thinking of contacting you about a collaboration,’ she said.”
The next day, strolling along San Juan’s cobblestone streets, the discussion turned to Cas9. “We have to figure out exactly how it works,” Charpentier urged Doudna. Doudna responded: “What’s the exact mechanism it uses to cut DNA?” Isaacson tells us: “Charpentier was taken by Doudna’s seriousness and attention to detail. ‘I think it’s going to be fun to work with you,’ she told her.”
“I’ve got a wonderful biochemist who’s also a structural biologist,” she told Charpentier. They agreed that they would connect Jinek with the postdoc in Charpentier’s lab who had worked on her earlier Cas9 paper, Krzysztof Chylinski, a Polish-born molecular biologist who had stayed in Vienna when she moved to Umeå. Together, this foursome would make one of the most important advances in modern science … The collaboration was like a model United Nations: a Berkeley professor from Hawaii, her postdoc from the Czech Republic, a Parisian professor working in Sweden, and her Polish-born postdoc working in Vienna.
“Doudna’s collaboration with Charpentier first discovered that tracrRNA created the crRNA guide and, more importantly, held it together with the Cas9 enzyme, binding it to the target DNA for the cutting process. Their second accomplishment was the invention of a way to fuse these two RNAs into a single-guide RNA. By studying a phenomenon that evolution had taken a billion or so years to perfect in bacteria, they turned nature’s miracle into a tool for humans …
“On June 8, 2012, Doudna hit the Send button on her computer to submit the manuscript to the editors of the journal Science. It listed six authors: Martin Jinek, Krzysztof Chylinski, Ines Fonfara, Michael Hauer, Jennifer Doudna, and Emmanuelle Charpentier … Although many of the activities of CRISPR-Cas9 in living cells had been described before, it was the first time researchers had isolated the essential components of the system and discovered their biochemical mechanisms. In addition, the paper contained a potentially useful invention: the single-guide RNA.”[emphasis added]
And so it was that their mutual respect for each other’s intelligence turned into a sincere affection for each other, and allowed them to bridge any disputes and accomplish great things together, including winning several prestigious and generous awards, including the Nobel Prize.
I’ll leave it to you to explore in further depth the darker side of the CRISPR competition. Thankfully, these all too human deficiencies never quite managed to overwhelm the near heroic efforts of so many to save and make better so many millions of lives.
I’ve scratched the surface of Isaacson’s story. “The Code Breaker” is multi-faceted, always insightful, and often exciting. It pairs science with philosophy, connecting the technical to the spiritual. Revealing how much we’ve gained by learning ever more about gene editing, while counseling that we never lose track of what we might lose.
Some final thoughts. It took Dudna’s colleague, Jennifer Hamilton, a day to teach Isaacson how to use CRISPR to edit human genes. Not surprisingly, as he learned even more about CRISPR, he imagined the many ways the tool could be used. Possibilities that might permanently alter the human race. For good, like “using CRISPR to engineer inheritable edits in humans that would make our children, and all of our descendants, less vulnerable to virus infections.”
Or for discretionary gene editing, something perhaps less than noble: “Allow parents to enhance the IQ and muscles of their kids? Should we let them decide eye color? Skin color? Height?”
Isaacson asks: “What might that do to the diversity of our societies? … If we are no longer subject to a random natural lottery when it comes to our endowments, will it weaken our feelings of empathy and acceptance? If these offerings at the genetic supermarket aren’t free (and they won’t be), will that greatly increase inequality … Perhaps we should develop some rules …”
Isaacson suggests that “figuring out if and when to edit our genes will be one of the most consequential questions of the 21st century, so I thought it would be useful to understand how it’s done. Likewise, recurring waves of virus epidemics make it important to understand the life sciences. There’s a joy that springs from fathoming how something works, especially when that something is ourselves. Doudna relished that joy, and so can we. That’s what this book is about.” [emphasis added]
